recombinant human il12 p70 (PeproTech)

PeproTech is a verified supplier

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

PeproTech recombinant human il12 p70
KEY RESOURCES TABLE

Recombinant Human Il12 P70, supplied by PeproTech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/recombinant+human+il12+p70/il+7+cytokine/pmc10285879-70-0-5
Average 90 stars, based on 1 article reviews

recombinant human il12 p70 - by Bioz Stars, 2026-09

90/100 stars

Images

1) Product Images from "KSHV infection drives poorly cytotoxic CD56-negative natural killer cell differentiation in vivo upon KSHV/EBV dual infection"

Article Title: KSHV infection drives poorly cytotoxic CD56-negative natural killer cell differentiation in vivo upon KSHV/EBV dual infection

Journal: Cell reports

doi: 10.1016/j.celrep.2021.109056

Figure Legend Snippet: KEY RESOURCES TABLE

Techniques Used: Purification, Virus, Produced, Recombinant, Staining, Biomarker Discovery, Modification, Software

Recombinase Polymerase Amplification:

Article Title: KSHV infection drives poorly cytotoxic CD56-negative natural killer cell differentiation in vivo upon KSHV/EBV dual infection.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER FITC mouse anti-human CD94 (Clone: DX22) Biolegend Cat#305504; RRID:AB_314534 FITC mouse anti-human CD2 (Clone: RPA-2.10) Biolegend Cat#300206; RRID:AB_314030 FITC mouse anti-human CD107a (Clone: H4A3) BD Bioscience Cat#555800; RRID:AB_396134 FITC mouse anti-human CD158a,h,g (Clone: HP-MA4) Biolegend Cat#339504; RRID:AB_2130378 FITC mouse anti-human CD158b (Clone: DX27) Biolegend Cat#312604; RRID:AB_2296486 FITC mouse anti-human CD3 (Clone: UCHT1) Biolegend Cat#300406; RRID: AB_314060 PerCp mouse anti-human CD8 (Clone: SK1) Biolegend Cat#344708; RRID:AB_1967149 PE mouse anti-human CD159a/NKG2A (Clone: Z199) Beckman Coulter Cat#IM3291U; RRID:AB_10643228 PE mouse anti-human CD328/Siglec-7 (Clone: 6-434) Biolegend Cat#339204; RRID:AB_1501160 PE mouse anti-human CD19 (Clone: HIB19) Biolegend Cat#302208; RRID:AB_314238 PE/Dazzle 594 mouse anti-human CD186/CXCR6 (Clone: K041E5) Biolegend Cat#356016; RRID:AB_2563974 PE/Dazzle 594 mouse anti-human CD57 (Clone: HNK-1) Biolegend Cat#359620; RRID:AB_2564063 PE/Dazzle 594 mouse anti-human CD127 (Clone: A019D5) Biolegend Cat#351336; RRID:AB_2563637 PE-Cy5.5 mouse anti-human CD158a,h (Clone: EB6B) Beckman Coulter Cat#A66898; RRID:AB_2857330 PE-Cy5.5 mouse anti-human CD158b1/b2,j-PC5.5 (Clone: GL183) Beckman Coulter Cat#A66900; RRID:AB_2857331 PE-Cy7 mouse anti-human CD38 (Clone: HB7) BD Bioscience Cat#335790; RRID:AB_399969 PE-Cy7 mouse anti-human TNF-a (Clone: MAb11) BD Bioscience Cat#557647; RRID:AB_396764 PE-Cy7 mouse anti-human CD56 (Clone: NCAM16.2) BD Bioscience Cat#335826; RRID:AB_2857328 PE-Cy7 mouse anti-human Nkp46 (Clone: 9E2) BD Bioscience Cat#562101, RRID:AB_10894195 APC mouse anti-human NKp46 (Clone: 9E2) BD Bioscience Cat#558051; RRID:AB_398653 Alexa Fluor 700 mouse anti-human Granzyme B (Clone: GB11) BD Bioscience Cat#560213; RRID:AB_1645453 Alexa Fluor 700 mouse anti-human CD19 (Clone: HIB19) Biolegend Cat#302226; RRID:AB_493751 Alexa Fluor 700 mouse anti-human CD158e1 (Clone: DX9) Biolegend Cat#312712; RRID:AB_2130824 APC-Cy7 mouse anti-human CD16 (Clone: 3G8) Biolegend Cat#302018; RRID:AB_314218 APC-Cy7 mouse anti-human CD127 (Clone: A019D5) Biolegend Cat#351348; RRID:AB_2629572 APC-Cy7 mouse anti-human CD62L (Clone: DREG-56) Biolegend Cat#304814; RRID:AB_493582 (Continued on next page) e2 Cell Reports 35, 109056, May 4, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER APC-Cy7 mouse anti-human CD4 (Clone: RPA-T4) Biolegend Cat# 300518; RRID:AB_314086 Mouse anti-EBNA2 (Clone: PE2) Abcam Cat#ab90543; RRID:AB_2049594 Rat anti-LANA (Clone: LN53) CliniSciences Cat#Mob395; RRID:AB_2860565 Rabbit anti-human CD20 (Clone: SP32) Cell Marque Cat#120R-16; RRID:AB_2860563 Mouse anti-IRF4/MUM1 (Clone: MUM1p) CliniSciences Cat#Mob420; RRID:AB_2861384 Purified anti-human NKp46 (Clone: BAB281) Beckman Coulter Custom Purified Bulk Antibody (IMBULK1C) Goat anti-human IgM-UNLB (polyclonal) Southern Biotech Cat# 2020-01 RRID:AB_2795599 Rituximab Roche Pharma (Schweiz) AG MabThera Bacterial and virus strains EBV B95-8-GFP (EBVwt) produced in HEK293 Delecluse et al., 1998 N/A EBV B95-8-BZLF1KO-GFP (EBVzko) produced in HEK293 Feederle et al., 2000 N/A rKSHV.219 Vieira and O’Hearn, 2004; Kati et al., 2015 N/A Biological samples Human Fetal Liver samples Advanced Bioscience Resources N/A Chemicals, peptides, and recombinant proteins Zombie Aqua Fixable Viability Dye Biolegend Cat#423102 Zombie NIR Fixable Viability Dye Biolegend Cat#423106 LIVE/DEAD Fixable Blue Dead Cell Stain Kit ThermoFisher Scientific Cat#L23105 TPA (12-O-Tetradecanoylphorbol 13- acetate) Sigma-Aldrich Cat#P1585 Recombinant human IL12 p70 Peprotech Cat200-12 Recombinant Human IL-18 Biolegend Cat#592102 TAPI-1 (ADAM-17 (TACE) and MMP inhibitor) Tocris Cat#6162 Critical commercial assays DNeasy Blood & Tissue Kit QIAGEN Cat#69506 MSD U-plex Biomarker Group 1 (Human) Meso Scale Discovery Cat#K15067L MSD V-PLEX Proinflammatroy Panel 1 Human Kit Meso Scale Discovery Cat#K15049D IL-18 Human ProcartaPlex Simplex Kit ThermoFisher Scientific Cat#EPX01A-10267-901 Experimental models: Cell lines Brk.219 Kati et al., 2013 N/A Experimental models: Organisms/strains NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ (NSG mice) The Jackson Laboratory Stock#005557 NOD.Cg-Mcph1Tg(HLA-A2.1)1Enge Prkdcscid Il2rgtm1Wjl/SzJ (NSG-A2 mice) The Jackson Laboratory Stock#009617 Oligonucleotides EBV BamHI forward primer: 50-CTTCTCAGTCCAGCGCGTTT-30 modified from Berger et al. (2001) N/A (Continued on next page) Cell Reports 35, 109056, May 4, 2021 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER EBV BamHI reverse primer:50-CAGT GGTCCCCCTCCCTAGA-30 modified from Berger et al. (2001) N/A EBV BamHI probe:50-(FAM)-CGTA AGCCAGACAGCAGCCAATTGT CAG-(TAMRA)-30 modified from Berger et al. (2001) N/A KSHV ORF26 forward primer: 50-GCTCGAATCCAACGGATTTG-30 modified from Tedeschi et al. (2001) N/A KSHV ORF26 reverse primer: 50-AATAGCGTGCCCCAGTTGC-3 modified from Tedeschi et al. (2001) N/A KSHV ORF26 probe: 50-(FAM)-TTCCCCATGGTCGTGC CTC-(BHQ-1)-30 modified from Tedeschi et al. (2001) N/A Software and algorithms R (v3.6.3) R Core Team https://www.r-project.org RStudio (v1.2.5033) RStudio https://www.rstudio.com FlowJo (v10.6.2) FlowJo https://www.flowjo.com inform (v2.4.8) PerkinElmer N/A Phenochart (v1.0) PerkinElmer N/A Vectra 3.0 PerkinElmer N/A Prism (v8.4.3) GraphPad Software https://www.graphpad.com:443/ SPICE - Simplified Presentation of Incredibly Complex Evaluations Roederer et al., 2011 https://niaid.github.io/spice

Purification:

Virus:

Produced:

Recombinant:

Article Title: Fecal Microbiota Transplantation for Recurrent Clostridioides difficile Infection Associates With Functional Alterations in Circulating microRNAs.
Article Snippet: Human NCM356 colonic epithelial cell line (Incell, San Antonio, Texas, USA) and peripheral blood mononuclear cells (PBMC) were cultured in M3Base medium (M300F) and Roswell Park Memorial Institute medium 1460 (RPMI1460), respectively, supplemented with 10% fetal bovine serum (FBS) (10270-106; Life Technologies, Carlsbad, California, USA) and 1% Penicillin-Streptomycin (15070-063) in a humidified incubator at 37 C with 5% CO2. .. Treatment with cytokines was performed at the concentration of 50 ng/ml using recombinant human IL12 p70 (Peprotech, 200-12H), IL18/IL1F4 (R&D, 9124-IL-010), FGF21 (R&D, 2539-FG-025) or 4-1BB Ligand/TNFSF9 (R&D, 2295-4L025). .. For transfections, cells were plated in 6-well tissue culture plates and transfected with hsa-miR-20a-5p (YM00472205), hsa-miR-23a-3p (YM00470983), hsa-miR26b-5p (YM00472485), hsa-miR-28-5p (YM00471553), hsa-miR-130a-3p (YM00472237), hsa-miR-150-5p (YM00470312) miRCURY LNA miRNA mimics, miRNA control (YM00479902, Qiagen) at a final concentration of 20nM or with siRNA against DROSHA (Dharmacon, ON-TARGETplus Human DROSHA siRNA, SMARTPool, L016996-00-0005) or the respective siControl (Dharmacon, ON-TARGETplus non-targeting control pool, D-001810-1005) using Lipofectamine RNAiMAX (13778-150; Invitrogen, Carlsbad, CA, USA) according to manufacturer’s instructions.

Article Title: KSHV infection drives poorly cytotoxic CD56-negative natural killer cell differentiation in vivo upon KSHV/EBV dual infection
Article Snippet: TPA (12-O-Tetradecanoylphorbol 13-acetate) , Sigma-Aldrich , Cat#P1585. .. Recombinant human IL12 p70 , Peprotech , Cat#200-12. .. Recombinant Human IL-18 , Biolegend , Cat#592102.

Review

recombinant human il12 p70 (PeproTech)

Structured Review

Images

1) Product Images from "KSHV infection drives poorly cytotoxic CD56-negative natural killer cell differentiation in vivo upon KSHV/EBV dual infection"

Related Articles

Recombinase Polymerase Amplification:

Purification:

Virus:

Produced:

Recombinant:

Staining:

Biomarker Discovery:

Modification:

Concentration Assay:

Similar Products

Image Search Results